EST 782446 is a singleton


Sequence

>782446 (1 EST) Length=259 AAAGATGATACTTTACTATTTTGTTGCTTCCCACTGAGAAATTCCATAAAACAACTCTCCTACACTTACTCAATTGTTTT ATTATGTAAGCTTTTGACTATAAACACTATGAACAATTTGTAGTTCTATTTTTTAATTGCTTCGATTTTGGATACTTTTT TTGTTATTTTTGCTGTTTGTTTTTGTTTGAAAAGACCAATATTGTTTTTACTTTATTGTCTTTTTGTTTACTTTGTGAAT ATCCAAAATAGTTGCACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 782446: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824461713284AA143879MCCE0267.M1RSchistosoma mansoni, cercariae


Date: 0:36:14 on Sat 25 Nov 117.