EST 782447 is a singleton


Sequence

>782447 (1 EST) Length=490 AAAAATGCTAGTGAAAAAAATCAAAAGATTACTCAAGTCATTCATTGACTCAAATGATGTTGACGAAGCTACTGCAGCAT TGTTAGAATTAGATGCCCCTCATTTTCGTCATGAACTTGTTTTTCAGGCAATCATAATGGCTATAGAAATAAGCACAGAG GATGCGCGTGAACGTGTTATTCGTTTGCTGAAGGAATTATGTGCTTCAGTTGTTTTGACAGTCGACCAGTTAACTCTGGG TGTCAAACGTGTTTATGCTGAATTACCAGACTTACAAATAGATGTACCTGCTGCCTACACGTTAATGGAATTATTTATGA ACGGTGCCATTAAGGCTGGTTTTATACCAAGAAAGCTAGCTAACGAATTTACTACTAAACCTCGTAAACGTTTCATCTCA GAGACTGATTCAATTTATAGAACTAATAGTTCAAAACCCTGGTGAAGGACCAATTCAAGAGGCATGAATAAACAGGGCCG GNGATCGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 782447: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824471713285AA143880MCCE0268.M1RSchistosoma mansoni, cercariae


Date: 9:59:33 on Fri 24 Nov 117.