EST 782452 is a singleton


Sequence

>782452 (1 EST) Length=464 CTTCAATGAGTTTTCTTTTTGGAGCCAGGAAAACACCTGAAGAGCAGCTAAGAGATAGCAAACGAACTATTGCAAGAACA CTTAGAGAGATAGAAAGAGAAAAAGGTCAGTTGGAGAGGGAACGCACTCGAATAACAAATGAAATTCGTATGTTGGCAAA GCGTGGTCAGATTGATGCCGTCAGAGTAATGGCGAANAGTTAGTTCGAACAGACAGTTACATCAAAAAGTTTTCCTTGAT GCACTCAAATATTACAGCGTTGTCAATGAAAATTCAGACTTTAAAATCAACTGCCACGATGGCTTCAGCTATGAAACAGG TTGCGCTAACAATGAGAAAAATGAATGCAACTATGCAGTTACCTCAGTTCCAAAAGGTCATGATGGAGTTTGAAAAACAA GCTGAAACGATGGAAATGAAACAGGGTATGATGTCGGATGTGATANGATGATGCTATTGGAGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 782452: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824521713290AA143885MCCE0273.M1RSchistosoma mansoni, cercariae


Date: 3:47:56 on Sat 18 Nov 117.