EST 782463 is a singleton


Sequence

>782463 (1 EST) Length=156 GGTTAATCACATCATCACTTACACATTACCGGTTACAATTTATTTATTTTGTTGAACTGTCATATTGATGTGTATGTGAG CTTGAAACAGTAACATATGCGTTTGTGTCATGTTCGAAAATATAACTTATAAAATTTACTTCAATATACCTCAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 782463: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824631713301AA143896MCCE0285.M1RSchistosoma mansoni, cercariae


Date: 11:56:25 on Fri 24 Nov 117.