EST 796350 is a singleton


Sequence

>796350 (1 EST) Length=315 AAAGATACATGGAAGAATCCAGAAAATATTACGGTTGGTTTTTTAGCTACAATATTAAAAATGATATCTAAAAAAGTAAA GAAATTACAAAATCCCTTAATATCTTATACACCTATCGATACATCTTATGCTTATCAAACTCCACCTTCTGTTCATGTAT CACAAAAAATGAATGAAAAAATAGACGAATTTTATGACGAGTTATCTTTTATATTAAATAATGAGGAGGTGCAAAGTACG GATATATCAGATACGAATGATATAAATGATGTATATGAAAGTTATAAAAAATTAACAGGTGAACACAAAAAAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 796350: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7963501710351U78746PFU78746Plasmodium falciparum NF54 (D.A.Fidock)


Date: 20:50:26 on Wed 22 Nov 117.