EST 796351 is a singleton


Sequence

>796351 (1 EST) Length=151 GCTGGTGCCGCTGCAGTAGAAACTGCTGAAGCTAAGAAAGAAGATAAGAAAGAAGAAAAGAAAGAAGAAGAAGAGGAAGA AGAAGACGACTTAGGATTTTCCTTATTTGGTTAAATATTAAATATTTTGAGGAACCAAAACAAAAACCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 796351: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7963511710352U78747PFU78747Plasmodium falciparum NF54 (D.A.Fidock)


Date: 13:32:12 on Thu 23 Nov 117.