EST 796353 is a singleton


Sequence

>796353 (1 EST) Length=170 GAAAATAGTGAACTAGAAGTTGTTTCCTGCTCACCTGTTGATAAAGAATATATTAAAGTTAGAGTTACCAAACAACAACA ACAACAACAACAAGAAGCATACGACGATGAAGATCATCAACCAGAAATGGAAGGTGGAAGAGTAGCTTGTGCTCGACAAT AAACAGTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 796353: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7963531710354U78749PFU78749Plasmodium falciparum NF54 (D.A.Fidock)


Date: 4:59:31 on Tue 21 Nov 117.