EST 796354 is a singleton


Sequence

>796354 (1 EST) Length=156 TCCCGCAATAGCGATAATACAGAAGGTAATTCAAAGGATGTAGAAATCAACGAATTTGTTAATTATATTAAGAACAATGC AAACCAAAAGAATGTCAATAAAAAGGATGTGGAAGACCACGTAAATGGGTTTAATAAGGATGGGGAAGAAATATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 796354: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7963541710355U78750PFU78750Plasmodium falciparum NF54 (D.A.Fidock)


Date: 5:58:37 on Thu 23 Nov 117.