EST 796356 is a singleton


Sequence

>796356 (1 EST) Length=117 ATGATACTAAAAAAGAAAACTGTGAAAGTTGCAAGAAAGATGTTGTTGAAGGATGTTCAACTGGTATGTGCCCATTACGA AACAATGATACTAAAAAAGAAAACTGTGAAAGTTGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 796356: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7963561710357U78752PFU78752Plasmodium falciparum NF54 (D.A.Fidock)


Date: 1:16:9 on Tue 21 Nov 117.