EST 800127 is a singleton


Sequence

>800127 (1 EST) Length=421 TGATGCAGTGTGCATCAGCCCAGATCTTAACTTGTGACAGTCCCTGGCAGTGGATGTGCTATAATGGCCAGTGTATCGCC CAGTATGATCTGTGTAATGGTATTGCACAGTGTACTGATGGATCCGATGAAATAGACTGTAATAAAAGGAAATGGCAGGA TAATGGGTACATGAATGTGCCCCGCGAGGAACTAATGAAATCAGCGATTTGGTCTGGAATGGATAAGGTTAGTCCAACCA GTGCTACTACTACATCTTTGTTTTCATCTGTGCTGTTTAATGAATGGCTTATCGCTGTGGTTTCCATCCTGTTCATCATA CTACTGGTGGTGATCGTCCTGCAGTGCCGACGACNACGAACTGGTCTAGCCCGTAGTAATCGTGCATACGGTATAAGGAG AAGTTAAATATGGGGCAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 800127: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8001271737510AA161717MBAFCE8F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:9:58 on Tue 21 Nov 117.