EST 800129 is a singleton


Sequence

>800129 (1 EST) Length=329 TTCAAACTCCTTTTAACTTATATTTCAGATTACTTATTGATTTAAAAATACTACTGAAGATACATTGTTACTTAGAACAA TGATTGCGACTACAATATATCTGTCTTTCTTTTTTTGCTTTCTATAAATGTAGAATTTTTGAAATCTTCATTGATTTGTC CACCGGGCTGCAGAATGATGGTATCTGTGATATACTATTAATTAGGAGCGGTTTAGTCAATTGCATAACTACTATAATTC TTTGCAAAAGCATCATTGCTGAACGGAATTTCTAGAACTATGTAATATTTGAATTAAGCTGAATGATGATTTAATATTGC GAATTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 800129: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8001291737512AA161719MBAFCE8F12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:12:32 on Thu 23 Nov 117.