EST 800136 is a singleton


Sequence

>800136 (1 EST) Length=276 TTTAGGCATGAATTCTAAGCTTGAAGTACCAGATCCAAGTGGACATGGCAGACGCGAAATTCATCTTTATTATGGTGGAC CATGGGCAAAAAGGCCGAATCATGCACCACACATTGAGGTTAAGATACCGGAAGTGTATAAGTTGAATTCATTGATTGGC GACAAATTAGCACAAATGAAATTTTCACTGCTAGAAGAAGATGCATTATTTTACATATTTTATAATTATCCGGGTGAGCA ATATCAAATTGCTGCTGCTTATGGGCTGTATGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 800136: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8001361737519AA161726MBAFCE8G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:24:35 on Wed 22 Nov 117.