EST 800139 is a singleton


Sequence

>800139 (1 EST) Length=69 GTGTATTTGACACGCTTTGTTGCAAATTCTATCTAAGACTTGGTGAGTTTGATGAATTTATTAATATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 800139: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8001391737522AA161729MBAFCE8G12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:36:58 on Sat 18 Nov 117.