EST 800149 is a singleton


Sequence

>800149 (1 EST) Length=337 TAAACCAGAATTCTTTTTCACTTTCTAGAAGTAGGTATTGATTGATCCAAACTGATAAGCATTTTTCTGTTAAATATGAA AGGGAGAGTTTGGAAGCTTGCAGTGTTTTGTGATATCGGATCATGTTCTACAGTTTCGAATTCGAAAATAAATCATCACT TTCTTATGTTGGCGCTGGACATGTTACTTTCTTTTGCATATTTGCGATTTTTTTCACGAAGTTTACGTTCCGTCTCTTGC TATTGTACTTTTAGAAGAGTTTTTTTGATAATCAGAAAATAAGTGGTAAAAAACGCGCATAATTTATCAAGCTGACTGAA GTTTCCCTTATTTTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 800149: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8001491737532AA161700MBAFCE9E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:24:22 on Fri 24 Nov 117.