EST 800179 is a singleton


Sequence

>800179 (1 EST) Length=401 CTAAAGTCTCTCTTTACCTGTGCCATTTCCTTATTCTCCTTTGAATCTTGACATCTTTTCTCATCATTTCTACTGCTAGT AATGCTTAGACAATATTAATTTGGCTATATCTCTTACTATTTGTTTAATCTTCAATGGCATTTAGCCGTTAGCTCTCTTA GCACATTGATTACTATTTGCTCAGTGCTATTATGACTATCTTTCTTACAATCTTTATTATAAGAAGATATATAAAAGGTA TTCTGAGTACAGGTATTTTGAGAAAAAAACAAAAACAAAAAAATCTCCAACATCTTCGATAAGATTATTGGTAAATTATG TTTTGAGATTTGCTGTANTTGTAAGGATCANTGGAAGACATTTAATGTCATTAAATTTGACAAGTTTCATCCTTAATAAA T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 800179: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8001791737562AA161552MBAFCF1A03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 9:33:30 on Sun 19 Nov 117.