EST 800184 is a singleton


Sequence

>800184 (1 EST) Length=379 GTGCCCTCTGCTACTTTACGATGAATTTGTTTTCCGATTCTTATCGCTTCCTGTTCCTAATATTTCTTGATTACAAAATA ATGGATTTATCATTGATAAGAATAAATTCGGCCAATGAATATTGCTAAGGATTCGTCCACCATCGTCTCACGGATATCAT ATGTCACTGATTGTTGATGAATATTTGATTATATTATAATTATTATCATTACCAATTTATTATTATTATTGTTAATTATT ACTTTTATTATTATTTACTATCATTAAGCGGAAGCTTTTAATGATTGTATTGGTCGGTTTTGTAATTGAATGATAGCTTT CTTGGCTGGCAAACATGAAAGTTTATTTCAATGAAGTCGAATAAATTCTGTTTAGCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 800184: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8001841737567AA161557MBAFCF1A10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:21:6 on Wed 22 Nov 117.