EST 800204 is a singleton


Sequence

>800204 (1 EST) Length=522 GCAATACAAAACGAAGAGATTGGATGTGTTCATATCAGCTGGTATCTTTCAACAATATCATATTTGGAAACATATCGTCA GCATATTGTTATTATCTTCTTTTTCACTGCTATTAATCTGTTACTATTCTCTGAACGATTTTGGCATTATCGATATGAAA CGGAGCACCGCGATCTGCGACGTGTCATGGGTGTAGGTATAGCAGTTACACGTGGTGCTGCCGCATCTTTATCCTTTTGT ATGGGACTCATTTTGATCACAGTTTGCCAAAATATTATCACGTTATTACGTGAAACTCCATTTCGCGAATATCTGCCTCT TGATTCAGCGATAGCATTCCATAAACTTGTAGCAATGACAGCTGGCTTCTGGGCTACGGTACATACGGTTGGAAACTGTA TCAATTTCTTATCAAGGATATTCTACACTTCTTGGCCATATCTTTCGAAAAGTTAGCCTTACATATTATTCACTGCTGTA TAAATAAACTTGCCCGACTCTTTGATCTCACTTTGTCTTTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 800204: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8002041737587AA161577MBAFCF1D05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:40:42 on Sat 25 Nov 117.