EST 800225 is a singleton


Sequence

>800225 (1 EST) Length=338 TAAACGTTTATGTTAGTGATTTATTCTTTTAACTAAAATACATTATTGCTTTGTAAAACACATCATTGCTTTGTATTCTC TTAAATTATTGCGCTTTCTTCGGTTGCCACGTATTACAGGAATGATGTCCATTATTAATTCCTATAACTTTTCTTTTGAA ATTGTGGAATGATTTCCACTTTACTTACGTCACTCTGGGTTGTCAGTTAGTCATTTTCGCTGATTCGTTTGTTATCGTTC ATCAATATGCTCGCATGTTCGATGTGTAATAATTACGAGTCAACTGTAACCGAATTCGGTGGCAGTATTTGTTTAAATAA AAATNTATCATTTAAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 800225: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8002251737608AA161598MBAFCF1F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 20:42:34 on Tue 21 Nov 117.