EST 800228 is a singleton


Sequence

>800228 (1 EST) Length=289 GTTTGTGTGAATGGTGCTGGTGCGGCTGTGCTGTGATGGCTGACTGTCTGCTGCTGAACACGTTGATCAAGTCGGTGAGG ACAGGTCGATCTCGCTCACGGCGACCACCACCACGCGACCTTGATCATGGATCAGCTGTTCCACAAGATTCAGTTACAGG TCATTACAAGAATCAAGCATATGATGAAGCACTGATCAATGAAAATAAGATCGTTGCATTTCCTAGCGTAGCGATGTATG AATCATCGTGTAATGATGTTGTGTACATAAAAAATCAACTGCTGGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 800228: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8002281737611AA161685MBAFCF1F12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 20:47:23 on Thu 23 Nov 117.