EST 800251 is a singleton


Sequence

>800251 (1 EST) Length=51 CCTCTTCAATTACCAGTTCCTTCTTAATTACAACAGTCACTTCAATTACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 800251: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8002511737634AA161750MBAFCF7B02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 7:27:47 on Sun 19 Nov 117.