EST 800278 is a singleton


Sequence

>800278 (1 EST) Length=348 GGAATTCATATGCTAAGCAATTCAGTGTTTTACCTTATTTCCTGAATCACCCCCTCCTGAGACGCTGACATTTATAATTT TCACTTTCCAATATTTGCTAGAAGTTCACTTTTTTGGAAGCATCAATGCATATTATCATAATGTGTAGAAATGCAAAAAT TTTAGTGTGCCGATGAAATTAATTACGAAACTTTTGATTTGATATTAATTAATAAAAATAAACATTTGAAATAATTCAAA AAAAAAACAATAATTTTACTTAAATGTTTGTTTCTTTTCCATTTCTTGCAATGCTTGAATCGCTACTTTGATGTCTTTTC CCGCTATTTTCCATTGTGTTTCTCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 800278: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8002781737661AA161631MBAFCF7D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:0:40 on Thu 23 Nov 117.