EST 800307 is a singleton


Sequence

>800307 (1 EST) Length=403 AATTATATAGCTGCACTGGATCATATTCTGGATAGTAATGTACAACCAAGTGCTTTAGAATATGCAAATATGTTAAGTAA TGGAATGAGTCAAACAACAACAAATTTAATTGCAACCTTACTTCGTGTACCACCTCGCTTACTTGCATTAACTCAACAGC AGCAATATCATCACCAACACCAACATCATCATCAACAGCACCAACAACAACAACAACATCAACAACAACAACACCAGCAC CAACAACAACAACATCAACAACAACGTTATCAACGCTTTCCTTGTTATCATCCAAATTATCATTCATATTTACAAGAGGA TGAATATAATCATCATAATCTTACATCTATCTTATATCCCACTAAATCAACAACTAATCTTTCGGAACGCATCTCACCCA TTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 800307: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8003071737690AA161660MBAFCG0D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:45:27 on Wed 22 Nov 117.