EST 800336 is a singleton


Sequence

>800336 (1 EST) Length=565 ATTTGAAGAAAATCGAAAATTATTGACCTCCTCATCTTCACAAGCATCTTCGATTGTAGCAGCTGGTACGGCGAGCCGTC AGTGCTGTCATTTCGGAAATGCTTTGATATATCAAACTGCTGCAACAGTGAATTATTTTATTTTTAACGCGACAAATGTG ACATATTACGCAAAACGATCGCTTCTATGGAAACAGCTCATCAAATAACACAAAAGGGAAGAATAAGCAACAACCGTGAA CCATTTTATACTTCCATACTTTCCTTTCTCTTCCATTTATTTTCTAAAACGCGCATAAAAATTTGTTGAGAACTTATATG ATTCAGAGAAATATCGCATGTAGTGTGTAAATTGCTAATAACTTTTAGTTGAAAATGTCTCCACTGAACGAAAATGATTT TTACAGTGTGAATTTACTATCTTATGTTTATTACGCATTGCTTGTGCAATGAAATGGATTGACGAACTGGCGCAAATATT AATTAATTTGAAGGAGTGGATGAGGTTGTNAACTTTTATTTTATTTGTTATTGTTATGTGTCAAAANCGCATGGAAATAA ATCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 800336: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8003361737719AA161540MBAFCG0G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:13:35 on Sun 19 Nov 117.