EST 800339 is a singleton


Sequence

>800339 (1 EST) Length=85 CGGCACGAGCAGAATTCAGAAATGTCTGATTTATGAACGAGCATCTGAATTGAGTTAAATAATTTTTTCGTAATTTTATT AGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 800339: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8003391737722AA161543MBAFCG0G11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:56:23 on Fri 17 Nov 117.