EST 800346 is a singleton


Sequence

>800346 (1 EST) Length=167 GGATATAAGACGGAGTCGAATATGGGTGAGTAAAAGATGAAAAAAATTTATGTGGAACGTCTTGAAATCTGCCAGCTTTC TAGTGATATAACTTTTACTACTGCTGCATGTACGCGGAGTGCACCTTTTTTGTTATGCAAATGTGTTCATAAAAGTTGAC TTACNAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 800346: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8003461737729AA161615MBAFCG0H09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:46:49 on Sat 18 Nov 117.