EST 800347 is a singleton


Sequence

>800347 (1 EST) Length=222 CAAACTAATAGTTGGGTCACCAACTTGCTTATTTTTAATTATCATTATGTCCTATTATATGAACTTCCACATCCATTCGT AACATTTGCTGTAGTGCTTTAGAGAAATGACTTAGATATGCTTTTCTTTCCAACTTTTCTTATTGTTCGTTGTTCTAATT TGTCTAAGTGTCTGTTTTTCATATATTTGTTGAACGTACTAAAGAATAAAAAGTTCCATGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 800347: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8003471737730AA161616MBAFCG0H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:21:39 on Fri 17 Nov 117.