EST 819591 is a singleton


Sequence

>819591 (1 EST) Length=539 CAGCGGAACTTCCTAAAATTTATCAATTTATTGATAAACGTTTCTTAATGTCATCTGAATTTTATGGAACTTTCAAACCA AAAATGGATTTTAATGCTGAAACAGCAGCTGATGTATTATATGATGCGATGAAAGGTTCAGGATGTGACAAATATCGTGT CATTCAGGTCATCGCTCATTGCAACAATGCACAACGATTAATGATTCGTACGCCGTACAGAAATAAGTATGGAAAGGATT TGATTGATGAGCTGAAAAAGGAATTATCAGGTGATTTTGAAGATGTCATCATTGGATTAATGGAAACACCAACTAAATAT GATGCTATGCAACTGCAAAAAGCTATGAAGGGTGTGGGGACAACAGANATAACATTAATTGATATTCTATGCTCTCGAAA TGATGATGAATTAAATGCAATTAAAAATGAATACAAGGATGAGTTTGGTAGAACATTGGAAAGTGATATTGTTGGTGATA CAAGCGGTGATTTCAAAGAATTACTCTTANCATTGCTTAATACTCGTCGTGATCGATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 819591: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8195911763772AA180554MBAFCF7E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:53:19 on Sat 18 Nov 117.