EST 819601 is a singleton


Sequence

>819601 (1 EST) Length=523 AGAAAGTGATACTGCCTTAGTGCTTACATCACATAGTATGGAGGAATGTGATGCGCTTTGTACACAAATTGCAATTATGA CAAACGGTGAATTCCGATGTCTTGGCAGTACGCAGCATATTAAGTCAAAATATGGTAGTGGATATAGCTTAGCAATACGA TTATACACAACTAATCAAATTGAATCAGCAAAAGAATTGATAACAAAAATGTCTCCTAATGCTCGATTAATGGATGAGCA TATATTACATTTAAATTATGAATTAATGATAGAGAAAGGACAGAAATGGTCAATGCTCTTTGAAAAAGTGGGAAAGCTAG CAGAATTAATTGATGCAGCAGATTATTCAATCAGTCAAACAACGCTTGATCAGATATTTCTCGATTTTTCACGAAATGCA AGAACTGATATTGTTAAATCTCATTTCTGAAAAACGATTAAATGCTAGCAAATATTAATCGGAACTGATAATCTTTTATC ATTTTTGTCTTTCAAATNTGTTATAATCTTCATCTTTCATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 819601: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8196011763782AA180577MBAFCF7G05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:33:45 on Sat 25 Nov 117.