EST 819624 is a singleton


Sequence

>819624 (1 EST) Length=85 CTTATCTATTTTGCATTGTGTATTATTTATATGTAATTAACATGAAATTATACCGAACGATTGTGTAGAACTGGCGCCGA TTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 819624: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8196241763805AA180613MBAFCG1B03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:35:28 on Sat 25 Nov 117.