EST 819627 is a singleton


Sequence

>819627 (1 EST) Length=256 CTTCATTTTGCCATCATTGTCCTCAATTATGTGCACACATTGGTTGCTGGCGCTGTTGTTACCTTTATATGTAGTTAGTA TTAGGTCCCTTCTGCTATTTCATTATTCGGCTAGAAATGCTCTTTTGCATCCAAGTGATATGTCGAGATGATATTTAAAA CTAACCTAGTCATATCATATTGTTTTCACTTACCCGTATAACTTCTTAATAATTTGTATGGAATATGTATTTCCCCATAA TTAAAGTCATAAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 819627: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8196271763808AA180616MBAFCG1B06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:41:8 on Fri 17 Nov 117.