EST 819643 is a singleton


Sequence

>819643 (1 EST) Length=187 CTCTAGGCCGTTCATTGCTTTTTCTAAAATGGCTTAGGCCTGTTTGTCATGATTTCAGTCGTATTTATATGTCGTCATGC ATAATCACACTGTTTCATTTCTTTAATTGATTATCCTATGTGTATTTAGACGACAGTTTGATCTTTACATATTTATAATA AGAGTTTTATTAAATTTATTGTGTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 819643: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8196431763824AA180632MBAFCG1D01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 22:10:43 on Fri 17 Nov 117.