EST 819659 is a singleton


Sequence

>819659 (1 EST) Length=247 CTCGTGCCGAATTCGGGACGAGAAGAGAGATTGGTGCGTTCTTCAACATGTCTGGCAAAATCATAAACCGAATCTTTGAT CCACGAATAAAAACATTATCCAAATGATGAGTCCTGTGCCATCTCGATAAGTTACCGTGACTTCGCCTCGTGCCGAATTC GGCACGAGCCCATCCGCAGCTTCTCTCAGTGTTAAGATTTGTTTACAATTATATTGCTCGAATCCACCAGTAAAATATTG TTTTGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 819659: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8196591763840AA180648MBAFCG1E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:46:26 on Sun 19 Nov 117.