EST 819684 is a singleton


Sequence

>819684 (1 EST) Length=178 ATTTGTGGAATTTTTGGTATTCATGGTACATGTAGTTTTTTGGAATCCATTTAATTTTTTTCCAATAATTGAAACATCGC AATAGAGCAGTTGAGCGATGCTTCAAAAAGCTATTCATGGCCTTTTAATATCACTCTAAGGGATCAGTATGATTTTCATC AATAAATATCAGTTATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 819684: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8196841763865AA180569MBAFCG2E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 15:13:38 on Fri 24 Nov 117.