EST 819686 is a singleton


Sequence

>819686 (1 EST) Length=156 TCAAAGTGTAGTATCTGTTCTTATCAGCTTAATCTCTGATATGTGGTCAATCGATCACTTCGAGATTATCCTATTTTTGA GACCATGGTGGGTTTGAAGGGGCTTGCTCCTCACCTACCGCGGGTCGACCCGGTATTGCACCTACCTCCGGGAACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 819686: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8196861763867AA180571MBAFCG2F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 20:45:14 on Sun 19 Nov 117.