EST 819701 is a singleton


Sequence

>819701 (1 EST) Length=292 GTCAGTCCGTCATACTTGGTCATACGTCATATACCATCAATAAAACTATATTTTTCTGTTATTGTAATCATTTATGATTA ATTAATTGGTCGTGCTTACTGTTGGGGTTATATGTATTATTATTATATTTGCAACAATCGTTGCACAATTCCTTTGTGAC GTTCTTAAATTTTTTGATTAATTTCAACTGATGTGCGCGGACAGACCTTTCCCTTGCGTCTTCTTTTCTGCTTTCAATCT ATATGACTTACTTGGCAGTATTTTAAAAAGTTGTTTTGTTGAATAAACTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 819701: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8197011763882AA180664MBAFCG2G12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:51:43 on Tue 21 Nov 117.