EST 819731 is a singleton


Sequence

>819731 (1 EST) Length=164 GAAAAGGAAAAAGAAAACGAGCTCAAGAATAAAGCAAGAACAAATTTTTGCAACAGTATGTAGTTATGAACTGAAGCTTA CGTGACATTTTGCAGATAGAACTTCAGAAGTGTCAATTGTAAAACATGTTCCGATGTATCTGTATAAATACAGAATAATT CGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 819731: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8197311763912AA180694MBAFCG3D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:14:3 on Fri 24 Nov 117.