EST 819736 is a singleton


Sequence

>819736 (1 EST) Length=305 ATTTTGAAGAAGTGCTGGCAAGGTCGGTGAGAAATTCAGTTATAACATGAAATATTGTTGAGATAATTGAGTTGCTGCAG TAGCGTAAGTAGGTAGATTTGGTGGTTAGATTTGGGTCGCTGTTTTAAATCAGGAATTTATCATTTAAAACACTCACTTG TTAATGTACATAGTGCACTGGCAGTAAATTATATGCATTGTTACTTCATTACTTTATTAACCATTGGATTAAGTCAACCG ATAATGATTCAGACAGTGTAACTGACGTGCTCAGTTTCCTCTGTTGACTGTAAAGTGATTTTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 819736: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8197361763917AA180699MBAFCG3D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:28:0 on Tue 21 Nov 117.