EST 819738 is a singleton


Sequence

>819738 (1 EST) Length=133 CCTTTAAATTGTTGCATCCTTATCATACTTGGGCAACAAAATTACAAATACTTCACTTTTTAATCTTATATTTACCATTT CGGTTGTTGGCCAAAATTGTTTTGTTTTGTTCATCCCAAAATAAATTTTCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 819738: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8197381763919AA180701MBAFCG3D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 1:45:46 on Sat 18 Nov 117.