EST 819751 is a singleton


Sequence

>819751 (1 EST) Length=164 CCCGCAAAATTTCATTAAGTGCGGCAATTGTGAAGTTATTTGAGGACTTGTATCAAGTGCCTCGTTTGGTACTTATTATC CTTGTTGACGGTAATATTTATATTCCTGCTTTCTTCGTTTGATTCTTCATTTGTTATGTGATTTGTTTAGATTACTAAAT CTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 819751: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8197511763932AA180714MBAFCG3F11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:9:30 on Sat 18 Nov 117.