EST 819763 is a singleton


Sequence

>819763 (1 EST) Length=278 ATTTCATTTTACTTATGTTCCTTTGCATGCATCATGACAACATTCAATGAAATGGATGGGAGTGGTATGTTCAAATCAAG TAAGGTATTGAAATTGAATGGAGCCCACTGGTTCTTTTCAAAGCTTACTTGGTAGTTGTATATGCATGCTTGTTATATTT GCAGTTGATTTATTACTTATCCTTTTGTTCTGTTTGCTAATCATTTGTTTACTTCCTCCAGGTAACTGTTTGCATAATTA TGGTGGATTATATTGCATCATCATACAAATTTTCATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 819763: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8197631763944AA180726MBAFCG3H05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:19:56 on Fri 24 Nov 117.