EST 824786 is a singleton


Sequence

>824786 (1 EST) Length=464 TCGATCAGCAGCAGATCCAAGCGAGTGGTAACGCTCCTTGAATTCGTCAAAGGTGCGGCGCTGGTAGGCCTTGACCACAT CCGAGACGAACTGCTCGGCATGGATGTAGAGAACTTTGGCGTCGGGCTTGTCGGCCAGCAGCTTGTTGCCCACGGCATGC ACCAGGTGGGTCTTGCCCAGGCCCACGCCGCCGTAGATGAACAGCGGGTTGTACAGGTGCCCGGGCGAGCCCGCCACATG CATGGCGGCCGAGCGTGCCATGCGGTTGGCCGTACCTTCCACCAGGGTCTCGAAGGTCAGCGCGGCGTTCAGGCGCGTGC GAAAGACGGGCGCTGCCGCGTCTTCGCTGGTGACCGTGGGCACCGAGGTGACAATGGTTTCCGGCGGGGCCGAGCGCTCG CTGGAGGAGGGGCGGACGTAAGTCGTAACAACGCTTTCCCGCTGAGCGAGTGCCAACTCAAGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 824786: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8247861769637AA185823MAAD0103.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)


Date: 12:51:14 on Sat 18 Nov 117.