EST 824821 is a singleton


Sequence

>824821 (1 EST) Length=276 AGATTAAATTTATAAAATGATTTAAATGTAATTGTTAATCTAATTTCCGTATTAAGCTAGTGCAACTTTCATTGTGTTAA GTAATTCGGTGTGATTCGCACTAATTTAACTTTAGAATTAGTTCTTTATAATTTCCTTTCAGCAGGACATTCATCTGAAT TAATTTTGTGTAAAGTTCATCCAGTGGGGCAAATAATTCAACTAATGATTACCACGATAAAATCTGTATATAAATTAATG TATTGGGATGGGCCTCTATCAATTAAATTTTCTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 824821: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8248211769672AA185756MAAD0164.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)


Date: 16:25:30 on Sat 18 Nov 117.