EST 839049 is a singleton


Sequence

>839049 (1 EST) Length=450 TTTGAGGAANANAACTATGGAGAAGTTATACTTGGAGGTTTCATCTTATTTGTAGTATTCTTGGAATTGTTGATTCTAAA GTNTGCCGTAAAAGTCGANAAATTTGAATANTGGAAAACGAAACGCTAAACCTATTGGATAATAATNNTAGCAATGAAAT ACCNCAATCAGAGTTATGCGGTGATTTTATATTTTTATGACACGAACTTATCCAACGTCAACAAAATATCCTACTGTGTT AGCGATTCTTGATGCATTAATTTGTATTCTTTATATTATGTTATTTGGAATTGATGCAGCAATTGTTTATCTNAGAGTTT CCAATTTATTCATACTGTATCATATTAATGTTCCCCACCCATATGTTTANCAGTCCGAATAACACAATTAGCTATACCCT ATATGCTATTTTAACAACATTAAACGTTTGTTTGGATACCNGTCCCNAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 839049: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8390491795714AA199971SW3ICA2017SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:42:46 on Fri 17 Nov 117.