EST 849725 is a singleton


Sequence

>849725 (1 EST) Length=96 ATCAAGAAAATGGCTGGACAAAAAGAAGATAAACAGGACTTCCGAGCAAATCTTAAAGTGGTCAAAAAGGATAATGTCAT CGATGATATCGTTAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 849725: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8497251809176AA210647SWMFCA408SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:22:41 on Sun 19 Nov 117.