EST 849726 is a singleton


Sequence

>849726 (1 EST) Length=617 CCTTNACGATAGTCGACGTCCTCAATGGNGGGCGATGAGACGAGACGTCCGGAATAGNGTCANGATAGAAACTAGCAGAT AAGCTTGCCTGACGTTTGTTCAGCTTAACTTGAAGCAATCATAGGTACTGACGTAGCTGCTGCTGCTACTGCTATTACTA CTACTAATACTACTGCTGTTGCTGCTGCTAATGCTAGCACTACTGCTACTTACTGATAGTTGTGATGGTGATGATGAGAA TGACGTCTTTTGTGCGTCCTCTCATCTTTTGAAAAGTTCAGATTGCTTATTATGCTTTGGATGGTCCTTGATTTTGTACT TATATCGTACTAAACAGACATTGTATTTAGAAAGACTATGATGTCGGGGAACAGATGATCAGGTGATGTGGACATTTGGG AAACAGTGTGGTATTTAATTCAGGGATAATTCATCTGCTTTATCAATGATTAATTGCTTCTTGATGTTAAATTTATTTGA GAGCTGTTATCCTGAGAATGTGAATGAATAAATGCACCAACCAGGTTTGAATGAAAGTGGACTCGAATTTAGAAAATATT GAGGACCATTAGAATTGGGATATTACGTCATTCACCCAGTTATGTTGCCCTAAGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 849726: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8497261809177AA210648SWMFCA437SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:42:57 on Thu 23 Nov 117.