EST 849732 is a singleton


Sequence

>849732 (1 EST) Length=352 AGAAGAAGCATTTAAAGCTCAATATATGCTTGTTGTACATGTTAGACGTCATACGGGTGAGAAGCCTAATGTCTGTACGT ATCCTGGTTGTGATAAATCATATAGTCGGTTGGAAAATTTAAAAACACATGTACGAACACATACTGAGAGAGCGTCCATA TCGATGTGAATTTCCGGAGTGTGGCAAAGCTTTTAGTAATGCATCCGATCGAGCAAAACATCAGAATCGCACACACTCCG ATACGAAACCATATCAGTGTATGANGGNNNGCTGCATAAAAAGCTACACAGATCCATCATCACTGAGGAAACACATTAAA TCGGTTCACGGTGATGAAGCGTATGAATTAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 849732: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8497321809183AA210654SWMFCA457SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:25:44 on Wed 22 Nov 117.