EST 849736 is a singleton


Sequence

>849736 (1 EST) Length=235 GCAGCATTCAAGCCAAAGCTGAGTTACGATGAGGATCAGAAGCAGGGGANAGCGATAAGTTATGTGTCGATATGTAATGT CACCCAGTGAATTCAGCTGATCACATTGAGATACTTCAGGCTGCCGTGATCGTGAGTGGGGTACAGCACTTTTGCAAGTT AGTGCTTGCTAACTAGATGTCCACATGCGGTTATGTACGTTAGTGTATGGATCTTTTTTTTTTTTTTTGGGNNGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 849736: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8497361809187AA210658SWMFCA600SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:54:55 on Sat 18 Nov 117.