EST 855827 is a singleton


Sequence

>855827 (1 EST) Length=222 GAATTCGTGGAAGGATTGTCTCATTTTGATAAAGAGGGAAATGGCTTAATCAATATTGCTGAATTGCGACATCTTCTAAC AACTCTCGGCGAACGTTTGTCAGATGAAGAAGTTGATCAACTTCTGGCTGGCCATGACGATTCACACGGCAATGTAAACA TTTCCGATTTTGTACGAGCCATTATGCNTGCCTAAAAACCANTACCCTTATAAAANTNCNTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 855827: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8558271817230AA216514MB2SLJ1A04T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 15:20:44 on Thu 23 Nov 117.