EST 857807 is a singleton


Sequence

>857807 (1 EST) Length=303 AACTAAATGGTATATTATTGATTTTTAAAAATGATCATCGGTGTAATCATTTAATGAATCCATTCAATGTTCCAGTATGG TTGTTTACTTTTTTGAATGTTCAATTTTGTCCTGTTGTTTTATGCATAGTACTAACTTATTTAATTTTTATTTTATATTC TTATATATAAAAATTAATTAAAACTTTATCGCTTGTCATTCGTATTGCTTTAAAGGGTGGTTTTTATTATTATTATTATT ATTATTATTATTATTGTTACTGACATTATTACTATTTACTATTCTCTTTCCTATATTTGTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 857807: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8578071832567AA218474MAAD0136.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 2:25:16 on Mon 20 Nov 117.