EST 857830 is a singleton


Sequence

>857830 (1 EST) Length=207 GTTATATGNTGCGGAGTACCAAAATGAAAATAATTTGGNTCCAATGACAAGAGAGGCGCTGTTTAATGGTCGTGGGTTGC CTTCAGGCAACAAGGATGAGGTTGTAAACAATCATTAATATATATGACTTCCCGGTGACTTCTGGGCATTTACCTAAGAT GCTCGCCACTTTAAGAATCCCCNAATTTTTTGANGTTAGGGTAACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 857830: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8578301832590AA218497MAAD0164Schistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 0:8:11 on Sun 19 Nov 117.